If you have been reading about Thiol and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2025-11-05. Numbers and descriptions here follow the published literature rather than marketing material.
Quantification of glutathione in biological or food samples commonly uses liquid chromatography coupled to ultraviolet, fluorescence, electrochemical, or mass spectrometric detection. Because the thiol group oxidizes readily, samples are often acidified or derivatized immediately after collection to stabilize reduced glutathione. Enzymatic recycling assays and colorimetric kits offer higher throughput but generally lower specificity than chromatographic methods. Mass spectrometry can distinguish glutathione from related thiols and allow simultaneous measurement of oxidized forms. Reported concentrations depend strongly on sample type, extraction procedure, and analytical platform.
Glutathione reference materials are sensitive to oxygen, light, and elevated temperature. Solid material is typically stored desiccated at -20 °C or below, while solutions require tighter control because thiol oxidation proceeds faster in liquid form. Aqueous solutions are often prepared fresh, kept cold, and protected from air; some protocols add acid or chelating agents to slow metal-catalyzed oxidation. Repeated freeze-thaw cycles can accelerate degradation and should be avoided. Stability data vary by matrix, so laboratories usually verify performance with their own storage conditions.
Glutathione is a small tripeptide built from glutamate, cysteine, and glycine. The peptide bond between glutamate and cysteine uses the gamma-carboxyl group, a linkage that resists ordinary peptidases. Cells make it in two ATP-dependent steps: gamma-glutamylcysteine synthetase joins glutamate and cysteine, then glutathione synthetase adds glycine. The pathway is feedback-inhibited by glutathione itself, so intracellular levels tend to stay within a narrow range. Because cysteine is often limiting, sulfur amino acid supply influences how much glutathione a cell can produce.
In its reduced form, glutathione carries a sulfhydryl group that can donate electrons. This property lets it act as a major cellular antioxidant and redox buffer. Glutathione peroxidase uses it to reduce hydrogen peroxide and lipid peroxides, while glutathione reductase regenerates the reduced form using NADPH. The ratio of reduced glutathione to glutathione disulfide is widely used as an indicator of oxidative stress, though the ratio changes with compartment, cell type, and sample handling. Oxidized glutathione can also form mixed disulfides with proteins, affecting their activity.
| Property | Value | Notes |
|---|---|---|
| Typical storage temperature | -20 °C or below | Desiccated solid; protect from light |
| Solubility | Soluble in water | Forms acidic solutions |
| Typical analytical method | LC-MS/MS | High specificity for thiols |
| Detection wavelength | 210–220 nm | For HPLC-UV of underivatized glutathione |
| Common synonyms | GSH; reduced glutathione | GSH refers to the reduced form |
Several techniques are used for quantification. Enzymatic recycling assays rely on glutathione reductase and a colorimetric or fluorescent readout, offering sensitivity for total glutathione. High-performance liquid chromatography can separate GSH from GSSG and other thiols, often with UV, fluorescence, or electrochemical detection. Mass spectrometry provides structural confirmation and can quantify low-abundance species when paired with separation. Each approach has trade-offs in specificity, throughput, and equipment requirements, so method selection depends on the research question and available instrumentation.
Stability depends on pH, temperature, oxygen exposure, and trace metals. Aqueous solutions of reduced glutathione are susceptible to oxidation, especially when neutral or alkaline and exposed to air. Transition metal ions can catalyze thiol oxidation, so chelators and inert atmospheres are sometimes used in research settings. Standards are typically stored cold and desiccated, with limited freeze-thaw cycles. Questions remain about how closely in vitro stability data reflect the behavior of glutathione within intact cells and tissues.
Glutathione is a small tripeptide composed of glutamate, cysteine, and glycine, with the unusual gamma-glutamyl linkage between glutamate and cysteine. Its cysteine thiol group makes it a major non-enzymatic antioxidant in cells. The reduced form, GSH, predominates in most intracellular compartments, while the oxidized disulfide form, GSSG, is produced when GSH reduces reactive oxygen species. Intracellular concentrations often reach millimolar levels, whereas plasma concentrations are much lower, typically in the low micromolar range. This gradient reflects active synthesis, transport, and consumption rather than passive distribution.
Synthesis occurs in two ATP-dependent steps: glutamate-cysteine ligase joins glutamate and cysteine to form gamma-glutamylcysteine, and glutathione synthetase adds glycine to complete the tripeptide. The pathway is feedback-inhibited by GSH and limited by cysteine availability, so cysteine supply often constrains production. Once formed, GSH participates in redox buffering, xenobiotic conjugation, and protein glutathionylation. Glutathione peroxidase uses GSH to reduce hydrogen peroxide and lipid peroxides, yielding GSSG, while glutathione reductase regenerates GSH using NADPH. Glutathione S-transferases conjugate electrophiles to GSH, supporting detoxification and excretion.
Because GSH is central to redox balance, its status is studied in aging, liver disease, neurodegenerative conditions, and metabolic disorders. Observational studies often report lower GSH or higher GSSG in affected tissues, but such associations do not establish that raising glutathione changes disease outcomes. Oral glutathione is digested into amino acids, and whether intact absorption occurs remains debated; precursors such as N-acetylcysteine and cysteine donors are also investigated. Regulatory agencies generally treat glutathione as a dietary supplement, not an approved drug, and clinical claims require evidence from controlled trials.
PEAKS and NovoHMM had the best sensitivity in both QSTAR and LCQ data as well. However, no evaluated algorithms exceeded a 50% of exact identification for both data sets. Recent progress in mass spectrometers made it possible to generate mass spectra of ultra-high resolution [1]. The improved accuracy, together with the increased amount of mass spectrometry data that are being generated, draws the interests of applying deep learning techniques to de novo peptide sequencing. In 2017 Tran et al. proposed DeepNovo, the first deep learning based de novo sequencing software. The benchmark analysis in the original publication demonstrated that DeepNovo outperformed previous methods, including PEAKS, Novor and PepNovo, by a significant margin. DeepNovo is implemented in python with the Tensorflow framework. To represent a mass spectrum as a fixed-dimensional input to the neural-network, DeepNovo discretized each spectrum into a length 150,000 vector. This unnecessarily large spectrum representation, and the single-thread CPU usage in the original implementation, prevents DeepNovo from performing peptide sequencing in real time. To further improve efficiency of de novo peptide sequencing models, Qiao et al. proposed PointNovo in 2020. PointNovo is a python software implemented with the PyTorch framework and it gets rid of the space consuming spectrum-vector-representation adopted by DeepNovo. Comparing with DeepNovo, PointNovo managed to achieve better accuracy and efficiency at the same time by directly representing a spectrum as a set of m/z and intensity pairs.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
=== September === 6 September – The Minister for Agriculture, Charlie McConalogue, farming groups, and the Irish Creamery Milk Suppliers Association (ICMSA) reacted to the European Commission decision to cut Ireland's nitrates derogation limits from 250 kg of organic nitrogen per hectare to 220 kg per hectare. The ICMSA president, Pat McCormack, said that the "Government has put a nail in the coffin of many family dairy farms that have been worked for generations". 7 September – During an appearance on RTÉ News at One, Taoiseach Leo Varadkar said he believes Ireland is "on the path to unification" and that there will be a United Ireland in his lifetime. 26 September – Officials recovered 2,253 kg of cocaine after boarding MV Matthew, a Panamanian-registered ship, off the coast of Ireland. The operation was described by Gardaí as the largest drugs seizure in Ireland's history. 27 September – Using Dáil privilege, Mary Lou McDonald revealed details of a letter confirming a meeting between clinicians and a representative from Children's Health Ireland, concerning experimental spinal surgeries on children at Temple Street Hospital. Nineteen children had poor surgical outcomes following surgery at Temple Street, and one of children later died. Whether parental consent had been obtained is in dispute.
Sources: en.wikipedia.org
== Food == Because odors strongly influence the quality and desirability of foods, headspace analysis is widely applied to both unprocessed and processed (i.e., cooked) foods. For example, the volatile components of roasted coffee beans and coffee itself have been analyzed in this way. Some odorants in coffees are aldehydes (isovaleraldehyde, isobutyraldehyde, and 2-methylbutanal and the thiol methanethiol. The aldehydes occur at the level of 200-1000 micrograms/L. Headspace gas chromatography has been applied to durian, which is infamous for its odor. The fruit emits the following organosulfur compounds: diethyltrisulfide, diethyldisulfide, dithiolane, dimethyl sulfide, and 3-methylthiazolidine.
== Medical implications == By culturing P. fluorescens, mupirocin (an antibiotic) can be produced, which has been found to be useful in treating skin, ear, and eye disorders. Mupirocin free acid and its salts and esters are agents currently used in creams, ointments, and sprays as a treatment of methicillin-resistant Staphylococcus aureus infection. Pseudomonas fluorescens demonstrates hemolytic activity, and as a result, has been known to infect blood transfusions. Pseudomonas fluorescens produces the antibiotic obafluorin. Recent case studies have reported instances of pneumonia caused by Pseudomonas fluorescens. These studies are significant as they identify P. fluorescens from lung biopsy specimens, providing insights into its pathogenic potential and informing treatment strategies based on antibiotic susceptibility testing. Ongoing research into the antimicrobial resistance mechanisms of the Pseudomonas fluorescens complex is exploring both intrinsic and acquired resistance to antimicrobial agents in strains isolated from various environments. This research is crucial for understanding the evolution of antimicrobial resistance and the role of P. fluorescens as a potential reservoir of clinically important resistance genes. Pseudomonas fluorescens is being studied for its biotechnological applications, particularly in the production of medium-chain-length polyhydroxyalkanoates (MCL-PHAs). These biodegradable polymers have potential uses in medical devices and drug delivery systems.
== Trigger mechanism == Insulin is synthesized and secreted in the beta cells of the islets of Langerhans. Once insulin is synthesized, the beta cells are ready to release it in two different phases. As for the first phase, insulin release is triggered rapidly when the blood glucose level is increased. The second phase is a slow release of newly formed vesicles that are triggered regardless of the blood sugar level. Glucose enters the beta cells and goes through glycolysis to form ATP that eventually causes depolarization of the beta cell membrane (as explained in Insulin secretion section of this article). The depolarization process causes voltage-controlled calcium channels (Ca2+) opening, allowing the calcium to flow into the cells. An increased calcium level activates phospholipase C, which cleaves the membrane phospholipid phosphatidylinositol 4,5-bisphosphate into Inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). IP3 binds to receptor proteins in the membrane of the endoplasmic reticulum (ER). This releases (Ca2+) from the ER via IP3 gated channels, and raises the cell concentration of calcium even more. The influx of Ca2+ ions causes the secretion of insulin stored in vesicles through the cell membrane. The process of insulin secretion is an example of a trigger mechanism in a signal transduction pathway because insulin is secreted after glucose enters the beta cell and that triggers several other processes in a chain reaction.
=== Prolactin-like activity === hPL has been found to bind to the prolactin receptor with equal affinity to that of prolactin in rabbit milk fat globule membrane, and hPL and prolactin have been found to possess very similar lactogenic activity in vitro in mouse and rat mammary gland explants. In addition, hPL has been found to stimulate DNA synthesis in human mammary fibroadenoma cells transplanted into mice, which suggests that hPL promotes the growth of the human mammary gland similarly to prolactin. As hPL circulates at concentrations that are 100-fold higher than those of prolactin during pregnancy, these findings suggest that hPL may play an important role in human mammogenesis during this time. However, the relative affinities of hPL and prolactin for the human prolactin receptor have yet to be published and the effects of hPL on normal human mammary epithelial tissue have not yet been investigated, and so a definitive role of hPL in human mammary gland development during pregnancy has not been established at present.
Sources: en.wikipedia.org
June 4: Tiananmen Square Massacre: Beijing protests are crushed by the communist Chinese government, resulting in an unknown number of deaths. June 4: Elections in Poland show complete lack of backing for the Communist Party; Solidarity trade union wins all available seats in the Parliament and 99% in the Senate. August 19: The opening of the border gate between Austria and Hungary at the Pan-European Picnic set in motion a chain reaction, at the end of which there was no longer a GDR and the Eastern Bloc had disintegrated. August 23: Baltic Way: independence protesters in Estonia, Latvia and Lithuania set up a human chain across the three Baltic states, from Tallinn to Vilnius via Riga. August: Parliament in Poland elects Tadeusz Mazowiecki as leader of the first non-communist government in the Eastern Bloc. October 7: Hungarian Socialist Workers' Party, the ruling party of Hungary, is dissolved. October 18: The Hungarian constitution is amended to allow a multi-party political system and elections. In East Germany, the nearly 20-year term of communist leader Erich Honecker comes to an end. November 7: Civil unrest occurred in Moldova. November 9: Revolutions of 1989: Soviet reforms have allowed Eastern Europe to change the Communist governments there. The Berlin Wall is breached when Politburo spokesman, Günter Schabowski, not fully informed of the technicalities or procedures of the newly agreed lifting of travel restrictions, mistakenly announces at a news conference in East Berlin that the borders have been opened.
In 1877, Schumacher adopted the Quaker symbol, the first registered trademark for a breakfast cereal. The acceptance of "horse food" for human consumption encouraged other entrepreneurs to enter the industry. Henry Parsons Crowell started operations in 1882, and John Robert Stuart in 1885. Crowell cut costs by consolidating every step of the processing—grading, cleaning, hulling, cutting, rolling, packaging, and shipping—in one factory operating at Ravenna, Ohio. Stuart operated mills in Chicago and Cedar Rapids, Iowa. Stuart and Crowell combined in 1885 and initiated a price war. After a fire at his mill in Akron, Schumacher joined Stuart and Crowell to form the Consolidated Oatmeal Company. The American Cereal Company (Quaker Oats, but see below) created a cereal made from oats in 1877, manufacturing the product in Akron, Ohio. Separately, in 1888, a trust or holding company combined the nation's seven largest mills into the American Cereal Company using the Quaker Oats brand name. By 1900, technology, entrepreneurship, and the "Man in Quaker Garb"—a symbol of plain honesty and reliability—gave Quaker Oats a national market and annual sales of $10 million (equivalent to $390 million today). Early in the 20th century, the Quaker Oats Company (formed in 1901 to replace the American Cereal Company) ventured into the world market. Schumacher, the innovator; Stuart, the manager and financial leader; and Crowell, the creative merchandiser, advertiser, and promoter, doubled sales every decade. Alexander P.
The human and animal data consistently indicate a lack of carcinogenicity via the oral route of exposure and limit the carcinogenicity of nickel compounds to respiratory tumours after inhalation. Nickel metal is classified as a suspect carcinogen; there is consistency between the absence of increased respiratory cancer risks in workers predominantly exposed to metallic nickel and the lack of respiratory tumours in a rat lifetime inhalation carcinogenicity study with nickel metal powder. In the rodent inhalation studies with various nickel compounds and nickel metal, increased lung inflammations with and without bronchial lymph node hyperplasia or fibrosis were observed. In rat studies, oral ingestion of water-soluble nickel salts can trigger perinatal mortality in pregnant animals. Whether these effects are relevant to humans is unclear as epidemiological studies of highly exposed female workers have not shown adverse developmental toxicity effects. People can be exposed to nickel in the workplace by inhalation, ingestion, and contact with skin or eye. The Occupational Safety and Health Administration (OSHA) has set the legal limit (permissible exposure limit) for the workplace at 1 mg/m3 per 8-hour workday, excluding nickel carbonyl. The National Institute for Occupational Safety and Health (NIOSH) sets the recommended exposure limit (REL) at 0.015 mg/m3 per 8-hour workday. At 10 mg/m3, nickel is immediately dangerous to life and health. Nickel carbonyl [Ni(CO)4] is an extremely toxic gas.
Sources: en.wikipedia.org
Acidification lowers pH and helps prevent oxidation of the thiol group during extraction and storage. It can also precipitate proteins and stabilize the reduced form before analysis.
Blood contains glutathione, but concentrations differ between plasma and red blood cells. Careful separation and rapid processing are needed because ex vivo oxidation and hemolysis can alter results.
An enzymatic recycling assay uses glutathione reductase and a thiol-reactive reagent to generate a signal proportional to total glutathione. It is convenient for many samples but may not distinguish reduced and oxidized forms without additional steps.
It is a tripeptide of glutamate, cysteine, and glycine. The glutamate-cysteine bond is unusual because it forms through the gamma-carboxyl group.